Journal: Journal of cell science

Article Title: Regulation of transient receptor potential canonical channel 1 (TRPC1) by sphingosine 1-phosphate in C2C12 myoblasts and its relevance for a role of mechanotransduction in skeletal muscle differentiation.

doi: 10.1242/jcs.035402

Figure Lengend Snippet: Fig. 1. Expression and subcellular localization of TRPC1 in C2C12 myoblasts. (A) Transient receptor potential canonical (TRPC) channel mRNA isoforms in C2C12 myoblasts. Lanes show amplified products of RT-PCR reactions. Total RNA (1 μg) obtained from C2C12 myoblasts was retro-transcripted and cDNA amplified as described in Materials and Methods. The PCR products were visualized on an ethidium-bromide- stained agarose gel. Data are representative of three independent experiments. β-actin amplification, used as an internal control, is shown. (B) TRPC1 expression in subcellular fractions of C2C12 myoblasts. Aliquots of proteins (25 μg) from cell lysates (Lys), cytosol (cyt), Triton-soluble (Ms) or Triton-insoluble (Mi) membrane were processed for western blotting analysis. A blot representative of three is shown. (C) Effect of TRPC1 silencing on channel expression. C2C12 myoblasts were transfected with SCR-siRNA (–) and TRPC1- siRNA (+) as described in Materials and Methods. Aliquots of proteins (30 μg) from cell lysate were subjected to western blotting analysis. A blot representative of three independent experiments with similar results is shown. Band intensity is reported as relative percentage with s.e.m. less than 15%. (D) Confocal immunofluorescence analysis of TRPC1 cell localization. C2C12 cells were grown on glass coverslips, fixed and stained with the primary antibody against TRPC1 (green). The cells were counterstained with TRITC-phalloidin (red) to reveal actin filaments. In the inset, a superimposed fluorescence and DIC image shows co-localization of TRPC1 with TRITC-conjugated WGA at the cell surface. Note that the immunostaining is markedly reduced in TRPC1-silenced cells compared with native and SCR-siRNA treated ones. The images are representative of at least three independent experiments with similar results.

Article Snippet: C2C12 cells grown on glass coverslips were fixed in 0.5% buffered paraformaldehyde (PFA) and immunodetected as previously described (Formigli et al., 2005) using rabbit polyclonal anti-TRPC1 (Santa Cruz Biotechnology) and mouse monoclonal antimyogenin (Sigma).

Techniques: Expressing, Amplification, Reverse Transcription Polymerase Chain Reaction, Staining, Agarose Gel Electrophoresis, Control, Membrane, Western Blot, Transfection, Immunofluorescence, Fluorescence, Immunostaining

Journal: Journal of cell science

Article Title: Regulation of transient receptor potential canonical channel 1 (TRPC1) by sphingosine 1-phosphate in C2C12 myoblasts and its relevance for a role of mechanotransduction in skeletal muscle differentiation.

doi: 10.1242/jcs.035402

Figure Lengend Snippet: Fig. 2. Effect of TRPC1 silencing on stretch-activated Ca2+-transients and SAC currents in C2C12 myoblasts. (A) C2C12 myoblasts were pre-loaded with Fluo3-AM and mechanically stretched with the tip of an AFM probe (thick grey line). Fluorescence images were acquired soon after mechanical stimulation at a rate of 1 image/second using a digital camera. The pseudo- colouring represents the global Ca2+ increase as indicated by the colour bar. Note the marked reduction and the absence of the Ca2+ transient in TRPC1 silenced cells. The images are representative of at least five to six independent experiments with similar results (number of stretched cells for each group=5). (B) Two patch pipettes were attached to the cells at (a) resting length and (b) after 20% cell stretching induced by the movement of the upper pipette in the longitudinal direction. (C) Representative total current traces, (a) Im* recorded in bath solution by whole cell path-clamp; (b) leak current, Im,leak, recorded in the presence of GdCl3 added in the bath solution and (c-j) SAC-mediated current; Im, evaluated by detracting Im,leak from Im*; (c-f) SAC-mediated currents (Im) in SCR- and TRPC1-siRNA cells unstimulated and (g-j) S1P- stimulated evaluated before (c,e,g,i) and after (d,f,h,j) the application of the mechanical stretch; (k,l), currents normalized for Cm elicited by ramp voltage pulses from the same cell reported in panels a-j. siTRPC1, TRPC1-siRNA transfected cells; str, stretched cells.

Article Snippet: C2C12 cells grown on glass coverslips were fixed in 0.5% buffered paraformaldehyde (PFA) and immunodetected as previously described (Formigli et al., 2005) using rabbit polyclonal anti-TRPC1 (Santa Cruz Biotechnology) and mouse monoclonal antimyogenin (Sigma).

Techniques: Fluorescence, Transferring, Transfection

Journal: Journal of cell science

Article Title: Regulation of transient receptor potential canonical channel 1 (TRPC1) by sphingosine 1-phosphate in C2C12 myoblasts and its relevance for a role of mechanotransduction in skeletal muscle differentiation.

doi: 10.1242/jcs.035402

Figure Lengend Snippet: Fig. 3. Localization of TRPC1 in lipid microdomains of C2C12 myoblasts: effects of cholesterol depletion. (A) Localization of endogenous TRPC1 in lipid microdomains. Lipid-raft (DRM) and high-density (HDM) fractions were prepared as reported in Materials and Methods. An aliquot of each fraction (20 μl, 1/25 of total volume of 1-11 fractions) was resolved by SDS-PAGE and anti-caveolin 1 (Cav1), anti-TRPC1 and anti-calnexin immunodetected. A blot representative of three independent experiments with similar results is reported. (B) Sphingolipid content measurements. Sucrose density gradient fractions were prepared from [3H]sphingosine-labelled cells as described in Materials and Methods. Total radioactivity of unfractionated [3H]sphingolipids was determined in each fraction and reported as mean ± s.e.m. of a representative experiment performed in duplicate with similar results. (C) Co-immunoprecipitation of TRPC1 and Cav1. Pooled DRM fractions (F3-F4) obtained from C2C12 cell fractionation were subjected to immunoprecipitation with rabbit polyclonal antibodies directed against TRPC1 as described in Materials and Methods and Cav1 immunodetected. A blot, representative of two independent experiments, is reported. (D) Confocal immunofluorescent localization of endogenous TRPC1 in lipid rafts (triple labelling). (a,b) Native C2C12 myoblasts and (d,e) C2C12 cells treated with MβCD for 30 minutes were incubated with Alexa Fluor 488-conjugated CT-B (green) to label lipid rafts, immunostained for TRPC1 (red) and (b,e) counterstained with Alexa Fluor 647-labelled phalloidin to reveal actin filaments. Inset: magnification of outlined area. Yellow spots in panels a and d indicate co-localization of red and green fluorescence signals. (c,f) Scatter plots of the distribution of red and green fluorescence intensity signals. Pixel intensity (PI) for each of the dyes along the lines (AB, CD) in the confocal image g are shown. The degree of co-localization of TRPC1 with CT-B is summarized in the histogram. The images are representative of at least three independent experiments with similar results. (E) Effect of lipid-raft disruption on TRPC1 expression. C2C12 myoblasts were pre-incubated for 30 minutes in media containing vehicle (–) and MβCD (+), collected and processed for lipid-raft (DRM) and high-density membrane fraction (showed fraction 11) purification as described in the Materials and Methods. An equal amount (20 μl) of fractions was evaluated for the presence of TRPC1 and Cav1 by western blotting analysis. A blot representative of three is shown. (F) Effect of MβCD treatment on Gm/Cm. C2C12 cells were incubated for 30 minutes with MβCD in the presence or in the absence of S1P. Transmembrane ion conductance and cell capacitance were analysed by whole cell patch clamp in K+-free bath solution. Data are mean ± s.e.m. of 12-15 different recordings (*P<0.05, **P<0.001).

Article Snippet: C2C12 cells grown on glass coverslips were fixed in 0.5% buffered paraformaldehyde (PFA) and immunodetected as previously described (Formigli et al., 2005) using rabbit polyclonal anti-TRPC1 (Santa Cruz Biotechnology) and mouse monoclonal antimyogenin (Sigma).

Techniques: SDS Page, Radioactivity, Immunoprecipitation, Cell Fractionation, Incubation, Fluorescence, Disruption, Expressing, Membrane, Purification, Western Blot, Patch Clamp

Journal: Journal of cell science

Article Title: Regulation of transient receptor potential canonical channel 1 (TRPC1) by sphingosine 1-phosphate in C2C12 myoblasts and its relevance for a role of mechanotransduction in skeletal muscle differentiation.

doi: 10.1242/jcs.035402

Figure Lengend Snippet: Fig. 4. Effects of stress fibre formation and cytoskeletal integrity on TRPC1-cortactin interaction, channel expression and localization. (A) Co-immunoprecipitation of TRPC1 with cortactin. C2C12 cells were incubated in the presence or absence (–) of 1 μM S1P or of 1 μg/ml DHCB, for 30 minutes and collected in lysis buffer and immunoprecipitation performed as reported in the Materials and Methods and Fig. 3C. A blot representative of three independent experiments of immunoprecipitation and TRPC1 immunoblot is shown (relative percentage is reported as mean ± s.e.m.). (B) Confocal immunofluorescence analysis of TRPC1 lipid microdomain localization (triple labelling). C2C12 myoblasts treated with (a,b) DHCB to inhibit actin polymerization or (d,e) S1P to induce stress fibre formation, were incubated with Alexa Fluor 488-conjugated CT-B (green), processed for TRPC1 immunostaining (red) and (b,e) counterstained with Alexa Fluor 647-labelled phalloidin to reveal actin filaments. Yellow spots in panels a and d indicate co-localization of red and green fluorescence signals. (c,f) Scatter plots indicate the distribution of TRPC1 and lipid-raft fluorescence intensity signals. The images are representative of at least three independent experiments with similar results.

Article Snippet: C2C12 cells grown on glass coverslips were fixed in 0.5% buffered paraformaldehyde (PFA) and immunodetected as previously described (Formigli et al., 2005) using rabbit polyclonal anti-TRPC1 (Santa Cruz Biotechnology) and mouse monoclonal antimyogenin (Sigma).

Techniques: Expressing, Immunoprecipitation, Incubation, Lysis, Western Blot, Immunofluorescence, Immunostaining, Fluorescence

Journal: Journal of cell science

Article Title: Regulation of transient receptor potential canonical channel 1 (TRPC1) by sphingosine 1-phosphate in C2C12 myoblasts and its relevance for a role of mechanotransduction in skeletal muscle differentiation.

doi: 10.1242/jcs.035402

Figure Lengend Snippet: Fig. 5. Effect of TRPC1 silencing on skeletal myogenic differentiation of C2C12 myoblasts. (A) Western analysis of TRPC1 silencing on the expression of myogenic markers. Confluent C2C12 myoblasts were transfected with SCR-siRNA (–) or TRPC1-siRNA (+), stimulated with (+) or without (–) 1 μM S1P and differentiation started as described in the Materials and Methods. The content of TRPC1, myogenin and α-sarcomeric actin were analysed by western blotting. A blot representative of at least three independent experiments with similar results and the relative percentage is shown (mean ± s.e.m.). (B) Confocal immunofluorescence and phase-contrast analysis of differentiating myoblasts. SCR-siRNA and TRPC1-siRNA cells were cultured on glass coverslips in DM, fixed and stained with the primary antibody against myogenin (green), and counterstained with TRITC-phalloidin to detect actin filaments (red). Parallel experiments were performed to reveal myotube formation by phase contrast. Note that silenced cells reveal reduced nuclear myogenin staining and polyhedral morphology typical of the undifferentiated cells and are unable to form multinucleate myotubes compared to SCR-siRNA cells. The images are representative of at least three separate experiments with similar results.

Article Snippet: C2C12 cells grown on glass coverslips were fixed in 0.5% buffered paraformaldehyde (PFA) and immunodetected as previously described (Formigli et al., 2005) using rabbit polyclonal anti-TRPC1 (Santa Cruz Biotechnology) and mouse monoclonal antimyogenin (Sigma).

Techniques: Western Blot, Expressing, Transfection, Immunofluorescence, Cell Culture, Staining

Journal: Journal of cell science

Article Title: Regulation of transient receptor potential canonical channel 1 (TRPC1) by sphingosine 1-phosphate in C2C12 myoblasts and its relevance for a role of mechanotransduction in skeletal muscle differentiation.

doi: 10.1242/jcs.035402

Figure Lengend Snippet: Fig. 6. TRPC1 expression during C2C12 myoblasts differentiation. C2C12 cells were grown until 95% confluence and then cultured for the indicated times in DM. (A) Western blotting analysis of TRPC1 expression. Cell lysates (30 μg) were prepared as described in the Materials and Methods and processed for western blotting analysis. A blot representative of three independent experiments with analogous results is shown. (B) Confocal immunofluorescence analysis showing TRPC1 expression in differentiating myoblasts. Cells at the indicated time were fixed and immunostained for TRPC1 (green). Counterstaining was performed with TRITC-conjugated phalloidin to reveal actin filament organization (red). The images are representative of at least three separate experiments with similar results.

Article Snippet: C2C12 cells grown on glass coverslips were fixed in 0.5% buffered paraformaldehyde (PFA) and immunodetected as previously described (Formigli et al., 2005) using rabbit polyclonal anti-TRPC1 (Santa Cruz Biotechnology) and mouse monoclonal antimyogenin (Sigma).

Techniques: Expressing, Cell Culture, Western Blot, Immunofluorescence

Journal: Journal of cell science

Article Title: Regulation of transient receptor potential canonical channel 1 (TRPC1) by sphingosine 1-phosphate in C2C12 myoblasts and its relevance for a role of mechanotransduction in skeletal muscle differentiation.

doi: 10.1242/jcs.035402

Figure Lengend Snippet: Fig. 7. Regulation of TRPC1 expression by known modulators of skeletal myogenesis. (A) Western blotting analysis of TRPC1 expression. C2C12 myoblasts were grown until confluence and cultured in DM in the presence (+) or absence (–) of TGFβ (1 ng/ml). Aliquots of proteins from cell extracts (25 μg) were subjected to western blotting. Proteins were immunodetected using specific anti-TRPC1, myogenin and α-sarcomeric actin antibodies. A blot representative of at least three independent experiments with analogous results and the relative percentage (s.e.m. less than 15%) are shown. (B) Confocal immunofluorescence analysis showing the effect of S1P and TGFβ on myogenin expression. Confluent C2C12 cells were cultured in DM in the presence of either 1 μM S1P or TGFβ, and stained with specific antibodies. Representative merged confocal fluorescence and DIC contrast images of C2C12 cells immunostained for myogenin (green) are shown. (C) Confocal immunofluorescence analysis showing the effect of S1P and TGFβ on TRPC1 expression. Cells processed as in B were stained with anti- TRPC1 antibodies (green). Counterstaining was performed with TRITC- phalloidin to detect actin filaments (red). The images are representative of at least three separate experiments with similar results.

Article Snippet: C2C12 cells grown on glass coverslips were fixed in 0.5% buffered paraformaldehyde (PFA) and immunodetected as previously described (Formigli et al., 2005) using rabbit polyclonal anti-TRPC1 (Santa Cruz Biotechnology) and mouse monoclonal antimyogenin (Sigma).

Techniques: Expressing, Western Blot, Cell Culture, Immunofluorescence, Staining, Fluorescence

Journal: Journal of cell science

Article Title: Regulation of transient receptor potential canonical channel 1 (TRPC1) by sphingosine 1-phosphate in C2C12 myoblasts and its relevance for a role of mechanotransduction in skeletal muscle differentiation.

doi: 10.1242/jcs.035402

Figure Lengend Snippet: Fig. 8. Effects of TRPC1-siRNA and 2-APB on Gm/Cm in differentiating unstimulated and S1P-stimulated C2C12 myoblasts. C2C12 differentiating cells were transfected with scrambled-siRNA (SCR) and TRPC1-siRNA (siTRPC1) or treated with 2-APB in the presence or in the absence of S1P and incubated in DM for 24 hours. Significance of differences: *P<0.05, **P<0.01 with respect to relative controls; §§P<0.01 of TRPC1-siRNA (siTRPC1) with respect to SCR-siRNA (one-way ANOVA). Data are mean ± s.e.m. of 14-18 independent cell recordings.

Article Snippet: C2C12 cells grown on glass coverslips were fixed in 0.5% buffered paraformaldehyde (PFA) and immunodetected as previously described (Formigli et al., 2005) using rabbit polyclonal anti-TRPC1 (Santa Cruz Biotechnology) and mouse monoclonal antimyogenin (Sigma).

Techniques: Transfection, Incubation

Journal: EMBO Reports

Article Title: SH3KBP1 promotes skeletal myofiber formation and functionality through ER/SR architecture integrity

doi: 10.1038/s44319-025-00413-9

Figure Lengend Snippet: ( A ) Western blot analysis of SH3KBP1 protein levels in total protein extracts obtained from growing (GM) or differentiating C2C12 cells (from 1 to 5 days). C2C12 differentiation is assessed by Myogenin expression and Tubulin is used as loading control. ( B ) RT-qPCR analysis of Sh3kbp1 gene expression level relative to housekeeping genes ( CycloB, Gapdh, GusB, Rpl41 , and Tbp ) in proliferating C2C12 cells (GM) or in differentiating C2C12 (1 to 5 days of differentiation). ( C ) Representative western blots analysis of SH3KBP1 protein downregulation in stable cell line constitutively expressing shRNA construct targeting Sh3kbp1 . Tubulin is used as loading control. ( D , E ) Representative immunofluorescence staining of myosin heavy chain (green) and myonuclei (red) in C2C12 stable cell lines expressing scramble shRNA ( D ) or shRNA targeting Sh3kbp1 ( E ) after 3 or 6 days of differentiation. Zooms are magnifications of images in white dots rectangles in 6 days old myotubes. Scale bars: 150 µm, 15 µm in zoom. ( F , G ) Representatives immunofluorescent staining of myosin heavy chain (green) and myonuclei (red) in stable cell line expressing Sh3kbp1 shRNA, co-transfected with plasmid coding either for mCherry ( F ) or the full-length human SH3KBP1 ( G ) after 5 days of differentiation. Scale bar: 150 µm. ( H ) Quantification of the percentage of myonuclei per clusters observed in ( D – G ) experiments. Statistical analysis performed using unpaired t tests where * P < 0.05; ** P < 0.01; *** P < 0.001. Comparison between shRNA Scramble and ShRNA- sh3kbp1 ( n = 8; biological replicates) for the “4–6” nuclei category P = 0.000014, for the “7–9” nuclei category P = 0.039, for the “10–15” nuclei category P = 0.00016 and for the “+ 15” nuclei category P = 0.004. Comparison between ShRNA- sh3kbp1 and ShRNA- sh3kbp1 + SH3KBP1 ( n = 3; biological replicates) for the “4–6” nuclei category P = 0.00008, for the “10–15” nuclei category P = 0.0076 and for the “+ 15” nuclei category P = 0.04. Boxplot whiskers represent the maximum and minimum data values. Center lines show the medians; box limits indicate the 25th and 75th percentiles as determined by R software and represents the middle 50% of observed values.

Article Snippet: Inhibition of autophagy maturation was performed by treating C2C12 myotubes with Bafilomycin-A1 (MedChemExpress, HY-100558) at 100 nM during 6 h. To generate C2C12 stably expressing shRNAs (shControl or shCin85), cells were transfected with plasmids encoding control shRNA (Mission pLKO.1-Puro non-mammalian shRNA control plasmid, Merck SHC002) or shRNA directed against SH3KBP1 (mission shRNA clone TRCN0000088508 targeting the 3’UTR sequence CCCACCACTCTAAGAGAAATT) and selected using 2 µg/mL of Puromycin (Gibco, A1113803) for 2 weeks.

Techniques: Western Blot, Expressing, Control, Quantitative RT-PCR, Gene Expression, Stable Transfection, shRNA, Construct, Immunofluorescence, Staining, Transfection, Plasmid Preparation, Comparison, Software

Journal: EMBO Reports

Article Title: SH3KBP1 promotes skeletal myofiber formation and functionality through ER/SR architecture integrity

doi: 10.1038/s44319-025-00413-9

Figure Lengend Snippet: ( A ) Representative immunofluorescence staining of 5 days C2C12 myotubes expressing either scramble or Sh3kbp1 shRNA and stained with sirTubulin ® . Scale bars, 10 µm. ( B ) Quantification of the microtubule bundle directionality (orientation angle normalized according to myotubes longitudinal axis) in myotubes using the “directionality plugin” of ImageJ ® . Data are pooled from three independent repeats ( n = 41 cells in scramble condition and n = 61 cells in Sh3kbp1 shRNA condition). “−90°” category P = 0.03; “+80°” category P = 0.02“ + 90°” category P = 0.017. Statistical analysis performed using unpaired t tests where * P < 0.05. Boxplot whiskers represent the maximum and minimum data values. Center lines show the medians; box limits indicate the 25th and 75th percentiles as determined by R software and represents the middle 50% of observed values. ( C, D ) Representative images of immunofluorescent staining of Pericentrin (red), PCM1 (green) and nuclei (Blue) in 5 days differentiated C2C12 myotubes expressing either scramble or Sh3kbp1 shRNA. Scale bars, 10 µm. ( E , F ) Quantification of the myonuclei peripheral staining of Pericentrin ( E ) or PCM1 ( F ) in 5 days differentiated C2C12 myotubes expressing either scramble or Sh3kbp1 shRNA. Data are pooled from three independent repeats. Error bars represent SD ( G ) MAP7 constructs used in the experiment. ( H ) Representative western blot of crude extracts of C2C12 cells expressing various GFP-MAP7 constructs (FL: Full length, NT: N-terminal part of MAP7; NTL: N-terminal long part of MAP7; M: Middle part of MAP7, CT: C-terminal part of MAP7 and CTL: C-terminal long part of MAP7) and GFP-DNM2 and stained for endogenous SH3KBP1 (top) or with anti-GFP (bottom) antibodies. ( I ) Representative western blot after GFP immunoprecipitation (MAP7 and DNM2 constructs) using GFP-Trap in C2C12 cell extracts ( H ). The membrane was revealed with anti-GFP (bottom) and anti-SH3KBP1 (Top) antibodies n .>3.

Article Snippet: Inhibition of autophagy maturation was performed by treating C2C12 myotubes with Bafilomycin-A1 (MedChemExpress, HY-100558) at 100 nM during 6 h. To generate C2C12 stably expressing shRNAs (shControl or shCin85), cells were transfected with plasmids encoding control shRNA (Mission pLKO.1-Puro non-mammalian shRNA control plasmid, Merck SHC002) or shRNA directed against SH3KBP1 (mission shRNA clone TRCN0000088508 targeting the 3’UTR sequence CCCACCACTCTAAGAGAAATT) and selected using 2 µg/mL of Puromycin (Gibco, A1113803) for 2 weeks.

Techniques: Immunofluorescence, Staining, Expressing, shRNA, Software, Construct, Western Blot, Immunoprecipitation, Membrane

Journal: EMBO Reports

Article Title: SH3KBP1 promotes skeletal myofiber formation and functionality through ER/SR architecture integrity

doi: 10.1038/s44319-025-00413-9

Figure Lengend Snippet: ( A ) SH3KBP1 constructs used in the experiment. ( B ) Representative western blot of crude extracts of C2C12 cells co-expressing GFP-DNM2 and various Flag-SH3KBP1 constructs (FL full length, N-term N-terminal part of SH3KBP1, C-term C-terminal part of SH3KBP1) and stained with anti-GFP (top) or anti-Flag (bottom) antibodies. ( C ) Representative western blot after DNM2-GFP immunoprecipitation using GFP-Trap and aforementioned C2C12 cell extracts ( B ). The membrane was revealed with anti-GFP (top), anti-Flag (middle) and anti-SH3KBP1 (bottom) antibodies. ( B , C ) Blots were repeated more than three times. ( D ) Representative images of extracted Tibialis Anterior muscle fiber stained for SH3KBP1 (green), DNM2 (red) and myonuclei (blue) (single Z plan). Scale bars, 10 µm. ( E ) Representative images of extracted Tibialis Anterior muscle fiber stained for SH3KBP1 (green), DHPR1α (for DyHydroPyridine Receptor alpha, red) and myonuclei (blue) (Max intensity of Z stacks plans). Scale bars, 10 µm. ( F ) Representative immunofluorescent staining of SH3KBP1 (green), Actin (red) and myonuclei (blue) in the time course of C2C12 cells differentiation: proliferation (Prolif) and 3 or 5 days of differentiation (diff day 3, diff day 5) are presented. ( G ) Representative immunofluorescent staining of SH3KBP1 (green), Actin (red) and myonuclei (blue or red) along the time course of primary myoblasts cells differentiation: proliferation (Prolif) and 3 or 10 days of differentiation (diff day 3, diff day 10) are presented. Scale bars, 10 µm.

Article Snippet: Inhibition of autophagy maturation was performed by treating C2C12 myotubes with Bafilomycin-A1 (MedChemExpress, HY-100558) at 100 nM during 6 h. To generate C2C12 stably expressing shRNAs (shControl or shCin85), cells were transfected with plasmids encoding control shRNA (Mission pLKO.1-Puro non-mammalian shRNA control plasmid, Merck SHC002) or shRNA directed against SH3KBP1 (mission shRNA clone TRCN0000088508 targeting the 3’UTR sequence CCCACCACTCTAAGAGAAATT) and selected using 2 µg/mL of Puromycin (Gibco, A1113803) for 2 weeks.

Techniques: Construct, Western Blot, Expressing, Staining, Immunoprecipitation, Membrane

Journal: EMBO Reports

Article Title: SH3KBP1 promotes skeletal myofiber formation and functionality through ER/SR architecture integrity

doi: 10.1038/s44319-025-00413-9

Figure Lengend Snippet: ( A , B ) Representative Immunofluorescent staining of Golgi (RCAS1, red) ( A ) or Endoplasmic Reticulum (ERP72, red) ( B ) and myonuclei (DAPI, blue) in 6 days differentiated C2C12 cells expressing either scramble-GFP-shRNA or GFP-shRNA targeting Sh3kbp1 gene. Scale bars, 100 µm. Zooms 1–4 are magnifications of the images in white dots. Scale bars: 100 µm. ( C ) GFP-tagged SH3KBP1 constructs used in the experiment. ( D ) Representative western blot performed on crude extracts of C2C12 cells expressing GFP-SH3KBP1 constructs and stained with anti-ERP72 (Top), anti-Calnexin (middle) and anti-GFP (bottom) antibodies. ( E ) Representative western blot performed after SH3KBP1-GFP construct immunoprecipitation (GFP trap assay) of C2C12 cells extracts ( D ) and stained with anti-ERP72 (top), anti-Calnexin (middle) and anti-GFP (bottom) antibodies. Blots were repeated more than three times. ( F ) Representative immunofluorescent images of GFP-SH3KBP1 constructs expression in 10 days cultured primary myofibers. (GFP, green; Actin, red and myonuclei, blue) Scale bars, 5 µm. ( G ) Control (Sh-Scramble) and SH3KBP1-depleted (Sh- Sh3kbp1 ) C212 myotubes, differentiated for 6 days, were analyzed for their content of LC3-I/LC3-II and SH3KBP1 proteins by western blot; Actin labeling was used as a loading control. ( H ) Fold change quantification of LC3-II/Actin ratios reported to the Scramble condition. ( n = 3; biological replicates) P = 0.002. Statistical analysis performed using unpaired t tests where ** P < 0.01. ( I ) Control (Sh-Scramble) and SH3KBP1-depleted (Sh- Sh3kbp1 ) C212 myotubes differentiated for 6 days were either left untreated or treated with 100 nM of bafilomycin-A1 during 6 h. After total protein extraction, LC3-I/LC3-II and Actin levels were analyzed by immunoblot. ( J ) Fold change quantification of LC3-II/Actin ratios reported to the untreated condition in each condition (Scramble or Sh3KBP1) ( n = 3; biological replicates) P = 0.0011. Statistical analysis performed using unpaired t tests where ** P < 0.01. ( K ) Quantification of the percentage of highly LC3-II positive myofibers in Tibialis Anterior muscles from WT or KI- Dnm2 R465W/+ injected with either PBS or shRNA targeting SH3KBP1 mRNA ( n > 3; biological replicates). Comparison between WT and WT-ShRNA- sh3kbp1 P = 0.0059, KI-DNM2 R465W and KI-DNM2 R465W -ShRNA- sh3kbp1 P = 0.0056. Statistical analysis performed using unpaired t tests where ** P < 0.01. Boxplot whiskers represent the maximum and minimum data values. Center lines show the medians; box limits indicate the 25th and 75th percentiles as determined by R software and represents the middle 50% of observed values. ( L ) Representative electron microscopy images of myofibrils and triads organization within Flexor digitalis Brevis muscles from WT mice injected with either PBS or AAV cognate vector expressing shRNA targeting SH3KBP1 mRNA. Scale bar = 0.2 µm or 100 nm.

Article Snippet: Inhibition of autophagy maturation was performed by treating C2C12 myotubes with Bafilomycin-A1 (MedChemExpress, HY-100558) at 100 nM during 6 h. To generate C2C12 stably expressing shRNAs (shControl or shCin85), cells were transfected with plasmids encoding control shRNA (Mission pLKO.1-Puro non-mammalian shRNA control plasmid, Merck SHC002) or shRNA directed against SH3KBP1 (mission shRNA clone TRCN0000088508 targeting the 3’UTR sequence CCCACCACTCTAAGAGAAATT) and selected using 2 µg/mL of Puromycin (Gibco, A1113803) for 2 weeks.

Techniques: Staining, Expressing, shRNA, Construct, Western Blot, Immunoprecipitation, TRAP Assay, Cell Culture, Control, Labeling, Protein Extraction, Muscles, Injection, Comparison, Software, Electron Microscopy, Plasmid Preparation

Journal: Mediators of Inflammation

Article Title: Elevation of IL-6 and IL-33 Levels in Serum Associated with Lung Fibrosis and Skeletal Muscle Wasting in a Bleomycin-Induced Lung Injury Mouse Model

doi: 10.1155/2019/7947596

Figure Lengend Snippet: IL-6 and IL-33 may synergistically cause muscle atrophy. (a) The quadriceps muscle of the mice was homogenized, and the lysate was analyzed by Western blotting with specific antibodies against STAT3, AMPK, and Atrogin-1. (b) C2C12 cells, mouse adherent myoblasts, were incubated with 2% horse serum for 72 hours and stimulated with recombinant mouse IL-6 and IL-33 in serum-free medium as indicated for 24 hours. The remaining cells were harvested, and the levels of p-STAT3, STAT3, p-AMPK α , and AMPK α in the cell lysate were analyzed by Western blotting. α -Tubulin and GAPDH were used as internal controls. The intensity of bands in the Western blots was measured by ImageJ software. The quantitative data were expressed as the means ± SD. ∗ p < 0.05 compared with control.

Article Snippet: C2C12 mouse adherent myoblasts were obtained from BCRC (Bioresource Collection and Research Center, Hsinchu, Taiwan).

Techniques: Western Blot, Incubation, Recombinant, Software, Control

Journal: International Journal of Molecular Sciences

Article Title: IRE1-XBP1 Pathway of the Unfolded Protein Response Is Required during Early Differentiation of C2C12 Myoblasts

doi: 10.3390/ijms21010182

Figure Lengend Snippet: IRE1 is required in C2C12 differentiation. ( a ) IRE1-knockdown cell lines #1, #2, and mock cells were evaluated for the expression of IRE1/ Ern1 mRNA. Results are means + SEM (three biological replicates). ** p < 0.01. ( b ) Differentiation was induced in IRE1-knockdown cell lines and mock cells. After 48 h, cells were observed under phase contrast. Black arrows show the immature myotubes. Scale bar = 100 µm. ( c , d ) Cells were harvested after differentiation induction at 48 h. mRNA expression of myogenic factors ( c ) and UPR relative factors ( d ) was analyzed by qPCR. Results are means + SEM (three biological replicates). * p < 0.05, ** p < 0.01.

Article Snippet: C2C12 mouse myoblasts were obtained from DS Pharma Biomedical (Osaka, Japan).

Techniques: Knockdown, Expressing

Journal: International Journal of Molecular Sciences

Article Title: IRE1-XBP1 Pathway of the Unfolded Protein Response Is Required during Early Differentiation of C2C12 Myoblasts

doi: 10.3390/ijms21010182

Figure Lengend Snippet: IRE1 ribonuclease activity is required in early phase of C2C12 differentiation. ( a ) Differentiation was induced in the presence or absence of IRE1 RNase inhibitor, STF-083010 (60 µM; black bars) or DMSO (gray bars) for various time intervals as indicated. ( b ) Identification of critical time period for inhibitory effect of IRE1 activity on C2C12 differentiation. Scale bar = 200 µm. ( c ) Fusion index of STF-083010- or DMSO-treated cells. Results are mean + SEM (three biological replicates). The different letters denote significant differences between groups at p < 0.05 by Tukey’s HSD test.

Article Snippet: C2C12 mouse myoblasts were obtained from DS Pharma Biomedical (Osaka, Japan).

Techniques: Activity Assay

Journal: International Journal of Molecular Sciences

Article Title: IRE1-XBP1 Pathway of the Unfolded Protein Response Is Required during Early Differentiation of C2C12 Myoblasts

doi: 10.3390/ijms21010182

Figure Lengend Snippet: XBP1 is required for C2C12 differentiation. ( a ) mRNA expression of Xbp1 and spliced Xbp1 were compared between XBP1-knockdown cells (XBP1-KD) and mock cells. Results are means + SEM (three biological replicates). Student’s t -test. ** p < 0.01. ( b ) XBP1-knockdown cells and mock cells were induced to differentiate until day 5. Cells were observed for immunofluorescent staining with anti-MHC antibody. Scale bar = 200 µm. ( c ) Fusion index of mock or XBP1-KD cells. Results are mean + SEM (three biological replicates). Student’s t -test. ** p < 0.01. ( d ) Cells were harvested on the indicated day. mRNA expression of each myogenic factor was analyzed by qPCR. Results are means + SEM (three biological replicates). Student’s t -test. * p < 0.05, ** p < 0.01.

Article Snippet: C2C12 mouse myoblasts were obtained from DS Pharma Biomedical (Osaka, Japan).

Techniques: Expressing, Knockdown, Staining

Journal: International Journal of Molecular Sciences

Article Title: IRE1-XBP1 Pathway of the Unfolded Protein Response Is Required during Early Differentiation of C2C12 Myoblasts

doi: 10.3390/ijms21010182

Figure Lengend Snippet: CDK5 is a downstream target of IRE1-XBP1 in C2C12 cells. ( a ) mRNA expression of Xbp1 and Cdk5 during C2C12 differentiation. Results are means + SEM (three biological replicates). Student’s t -test. ** p < 0.01. ( b ) An illustration of the predicted mouse Cdk5 promoter region. The region upstream of the Cdk5 gene comprises three XBP1-binding domains including CCAAT at −544 bp, TGCCACGTGG at −597 bp, and CCACGT at −1112 bp from the transcription start site. ( c , d ) Chromatin immunoprecipitation assay using a C2C12 genomic sample. Input DNA = positive control. Rabbit IgG was used as negative control ChIP ( c ). ChIP assay was performed by quantitative PCR analysis ( d ). Results are means + SEM (three biological replicates). Student’s t -test. * p < 0.05. ( e ) XBP1-knockdown and mock cells were transfected with the vector containing the Cdk5 promoter construct ( p 1400) or an empty vector. Cdk5 promoter activity was assessed by luciferase assay. Results are means + SEM (three biological replicates). Student’s t -test. ** p < 0.01.

Article Snippet: C2C12 mouse myoblasts were obtained from DS Pharma Biomedical (Osaka, Japan).

Techniques: Expressing, Binding Assay, Chromatin Immunoprecipitation, Positive Control, Negative Control, Real-time Polymerase Chain Reaction, Knockdown, Transfection, Plasmid Preparation, Construct, Activity Assay, Luciferase